Bruce -
 
The complementary strand to the primer 5'AACATTTACTGCCTCGTCTCC 3', we agree,
will be3' TTGTAAATGACGGAGCAGAGG 5'.  Since transcription runs 5'-->3' in
terms of the newly synthesized strand, why wouldn't that leave us at its
...AAATGTT 3' end heading back toward Gertrude and away from Amy?
 
For the newly synthesized, complementary strand to polymerize toward Amy,
i.e., adding nucleotides onto its 3' end, shouldn't the primer be:
      5'GGAGACGAGGCAGTAAATGTT 3'?
Perhaps we are misinterpreting the sequence data you gave us.  What is 5'
and 3' regarding the top and bottome lines?  Isn't the top line at the left
the 5' end of that sequence?  Please help us out.  Thanks, Wink