Subject: | |
From: | |
Reply To: | |
Date: | Sat, 1 May 2004 19:33:33 +0100 |
Content-Type: | text/plain |
Parts/Attachments: |
|
|
Dave said:
> 2 or 3 years will see some big advances in this library. I
> would ask list members if they have any verified code for
> any know honey bee allele that they pass this to me as I
> am currently collating such data.
Technophobes look away now.
The entire honeybee genome, all 200 Mbases, is freely available for download
from here:
http://www.hgsc.bcm.tmc.edu/projects/honeybee/
At the moment it is presented as files of DNA sequence, and hasn't yet been
annotated. To give you a flavour, this is the start of chromosome 1:
>gnl|Amel_1.1|Group1.1
TTTACGCCCGATTCCCAACACGGTCGCCTCTTATTATTTTCAAATAATTC
TTCTTTCTTTTTGTCGTACATTTATAATTGGCATCTTGCCGCATCTACTT
ATGTTTTCTCTATTGCGCTGCATCTCGAGCTGTACTCGCATGTGCTTGCT
TTTTACTCTACATATACATATATGTGGAGCAAAAGAGAAATCAGATAAAT
AGCAAACATATTTGTAATATATCTTTTAAAAATATGAATTTCGCAAGCAG
.....
If you want to look in the honeybee sequence for a specific gene then one
way to do it is to pick up the sequence of the gene from a related and
well-studied organism (e.g. fruit fly - Drosophila) from Genbank (e.g. from
here, http://www.ncbi.nlm.nih.gov/Genbank/GenbankSearch.html)
Then use the 'BLAST' program at the honeybee site, paste in your known gene,
and ask the honeybee database for something similar from honeybee. It will
likely find the honeybee version for you. In theory, as the Drosophila
genome is well known, you could identify most honeybee genes this way.
Knowing the code doesn't mean that you understand the organism of course.
However, it gives scientists the tools to achieve a lot in the future - and
the honeybee race comparisons you are interested in will be one of these
applications.
Gavin - not a honeybee geneticist, just a plant one.
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
-- Visit www.honeybeeworld.com/BEE-L for rules, FAQ and other info ---
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
|
|
|